View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_32 (Length: 390)
Name: NF1158_low_32
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 30 - 384
Target Start/End: Original strand, 13087640 - 13087994
Alignment:
| Q |
30 |
gaacagattcaaaaatcagcattagattcgacgatgcaaagaaccaatcagtatggatcccaaacctaaaatcatggggtgcaatgggagaaggtcataa |
129 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087640 |
gaacagattcgaaaatcagcattagattcgacgatgcaaagaaccaatcagtgtggatcccaaacctaaaatcatggggtgcaatgggagaaggtcataa |
13087739 |
T |
 |
| Q |
130 |
ctacttcgagcgcggaaatgtggatgccttcaccggacgtggaccatgcatcaaatcacgtgtttgccgcctcaacctcgcctcagacggatctgggtac |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087740 |
ctacttcgagcgtggaaatgtggatgccttcaccggacgtggaccatgcatcaactcacgtgtttgccgcctcaacctcgcctcagacggatctgggtac |
13087839 |
T |
 |
| Q |
230 |
caccatgggtggtactgcgactacgtggaggtcacctccactggtccccacaaaccttgttcccaaaccatcttctatgttgatgagtggcttgccaaag |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13087840 |
caccatgggtggtactgcgactacgtggaggtcacctccactggtccccacaaaccttgttcccaaaccatcttctatgttgatcagtggcttgccaaag |
13087939 |
T |
 |
| Q |
330 |
atgttgcaccctataacctcagtgttatcattgatcgttgtcgtctctctgctcc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13087940 |
atgttgcaccctataacctcagtgttatcattgatcgttgtcgtctcactgctcc |
13087994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University