View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_35 (Length: 386)
Name: NF1158_low_35
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 30 - 167
Target Start/End: Original strand, 51947136 - 51947272
Alignment:
| Q |
30 |
gaaaaagaacactacacgacaagaaaagctctgatcaattcgatgtacgctgtattcactcatgtcttccaatttcatatcaattctgtcaattttcagt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51947136 |
gaaaaagaacactacacgacaagaaaagctctgatcaattcgatgtacgctgtagtcactcatgtcttccaatttcatatcaattctgtcaattttcagt |
51947235 |
T |
|
| Q |
130 |
ttcgtttctgttcaacaattactctttaaggcttcaag |
167 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
51947236 |
ttcgtttctgttcaacgatttct-tttaaggcttcaag |
51947272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 230 - 301
Target Start/End: Original strand, 51947330 - 51947401
Alignment:
| Q |
230 |
gcagattaagtttgtgcgaattcataccatagccatggaagaaacgttgggttcagcaacaacgacaatcaa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51947330 |
gcagattaagtttgtgcgaattcataccatagccatggaagaaacgttgggttcagcaacaacgacaatcaa |
51947401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University