View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_52 (Length: 330)
Name: NF1158_low_52
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 94 - 262
Target Start/End: Complemental strand, 45698326 - 45698158
Alignment:
| Q |
94 |
cgttggtggttgagattgaaatttcagtttcttgttgccagagatcatgcattcattttcatcattgttcaactcgtatgtatcctctaggactctatat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45698326 |
cgttggtggttgagattgaaatttcagtttcttgttgccagagatcatgcattcattttcatcattgttcaactcgtatgtatcctctaggactctattt |
45698227 |
T |
 |
| Q |
194 |
aagcagatacattgtatgatttgatgagaatgtctgttaatttcttttccttttctaattgcacaggtt |
262 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45698226 |
aagcatatacattgtatgatttgatgagaatgtctgttaatttcttttccttttctaattgcacaggtt |
45698158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University