View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_73 (Length: 303)
Name: NF1158_low_73
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_73 |
 | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 142 - 225
Target Start/End: Original strand, 11994628 - 11994711
Alignment:
| Q |
142 |
taaagcggtgttttgttttttacgagccgtgttactgctattggtttgatggaaggatgttgttttctattctcctatgctact |
225 |
Q |
| |
|
||||||||||| |||||||| | ||| |||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
11994628 |
taaagcggtgtcttgtttttgatgaggcgtgttgctgctattggtttgatggaaggatgttgtttgctattctccagtgctact |
11994711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 154 - 226
Target Start/End: Complemental strand, 108605 - 108533
Alignment:
| Q |
154 |
ttgttttttacgagccgtgttactgctattggtttgatggaaggatgttgttttctattctcctatgctactc |
226 |
Q |
| |
|
|||||||| | ||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
108605 |
ttgtttttgatgaggcgtgttgctgctattggtttgatggaaggatgttgttttctattctccggtgctactc |
108533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University