View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_75 (Length: 301)
Name: NF1158_low_75
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 30 - 150
Target Start/End: Complemental strand, 38622996 - 38622875
Alignment:
| Q |
30 |
acagggttggttattaatggagttgttttgttgttactacttgtttcagcgtgtaagtgagtgggggaataaacaagaagcctgatgggagt-ggtgggt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38622996 |
acagggttggttattaatggagttgttttgttgttactacttgtttcagcgtgtaagtgagtgggggaataaacaagaagcctgatgggagtgggtgggt |
38622897 |
T |
 |
| Q |
129 |
acgaggagttaccaaaccaaaa |
150 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38622896 |
acgaggagttaccaaaccaaaa |
38622875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 142 - 185
Target Start/End: Complemental strand, 38622868 - 38622825
Alignment:
| Q |
142 |
aaaccaaaactaatctaacttaataataatgtcacaattaatgg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38622868 |
aaaccaaaactaatctaacttaataataatgtcacaattaatgg |
38622825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University