View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_78 (Length: 295)
Name: NF1158_low_78
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 29 - 287
Target Start/End: Complemental strand, 30831679 - 30831421
Alignment:
| Q |
29 |
aagaatatttaccattagagatcatttccttaacaattgagtcaaaaaatttgtagatattagaaagaatatttagcatatcaacaggaggagatccgaa |
128 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831679 |
aagaatatttagcattagagatcatttccttaacagttgagtcaaaaaaattgtagatattagaaagaatatttagcatatcaacaggaggagatccgaa |
30831580 |
T |
 |
| Q |
129 |
ccaatattataagcattccttatgatgcaaaatgaatgatttctcatccacgtagttcttctgaccatgccaaaatgatgatggaatatggtgagaaatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831579 |
ccaatattataagcattccttatgatgcaaaatgaatgatttctcatccacgtagttcttctgaccatgccaaaatgatgatggaatatggtgagaaatt |
30831480 |
T |
 |
| Q |
229 |
gggtctttactctttacctctaaggaatctaagtatgcataacttagcacattcatctc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831479 |
gggtctttactctttacctctaaggaatctaagtatgcataacttagcacattcatctc |
30831421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University