View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_91 (Length: 252)
Name: NF1158_low_91
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_91 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 29 - 124
Target Start/End: Original strand, 47425636 - 47425731
Alignment:
| Q |
29 |
agtttggacaccatactactaatcaagtgtcttggatatgtgagtaactaatgcgattaaggattcgttatacaagaagctttcactttagtgtaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47425636 |
agtttggacaccatactactaatcaagtgtcttggatatgtgagtaactaatgcgattaaggatttgttatacaagaagctttcactttagtgtaa |
47425731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 47425813 - 47425859
Alignment:
| Q |
206 |
atacaaggttgaatgagatgagaagtggaaagaaagatcgtcatatt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425813 |
atacaaggttgaatgagatgagaagtggaaagaaagatcgtcatatt |
47425859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University