View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_93 (Length: 251)
Name: NF1158_low_93
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_93 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 44026127 - 44025906
Alignment:
| Q |
30 |
gttgccacattaattacaagagtatatgcatgatgcaattgccattgccaactctcacacacttgccttaaaataaaataatatttgaaggactcaaaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44026127 |
gttgccacattaattacaagagtatatgcatgatgcaattgccattgccaactctcacacacttgccttaaaataaaataatatttgaaggactcaaaag |
44026028 |
T |
|
| Q |
130 |
aaaaataactttttgaggttggttcttcataacactgaagagttttgggttaaaaaagctaaatgctaaatggcactcacaaattttacactaattggga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44026027 |
aaaaataactttttgaggttggttcttcataacactgaagagttttgggttaaaaaagctaaatgctaaatggcactcacaaattttacactaattggga |
44025928 |
T |
|
| Q |
230 |
taacttcacatttatattctca |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44025927 |
taacttcacatttatattctca |
44025906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University