View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_97 (Length: 250)
Name: NF1158_low_97
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_97 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 4999993 - 4999773
Alignment:
| Q |
30 |
ccatcaacaccacaccataactatacacatcactcttctcagtcactttcagtgtataaccatattctgcaattaaattattatgaattagatatcaatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4999993 |
ccatcaacaccacaccataactatacacatcactcttctcagtcactttcagtgtataaccatattctgcaattaaattattatgaattagatatcaatc |
4999894 |
T |
 |
| Q |
130 |
agcactcaagtttcctaaaattgaacatatatagttacaattatgaagcacttacgcaaacacgaacaccggatacaacattgacacattaacataaata |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4999893 |
agcactcaagtttcctaaaattgaacatatatagttacaattatgaagcacttatgcaaacacaaacaccggatacaacattgacacattaacataaata |
4999794 |
T |
 |
| Q |
230 |
attccaaatcaccgataatca |
250 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
4999793 |
attccaaatcaccggtaatca |
4999773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 51820507 - 51820577
Alignment:
| Q |
30 |
ccatcaacaccacaccataactatacacatcactcttctcagtcactttcagtgtataaccatattctgca |
100 |
Q |
| |
|
||||||||||||| || |||||||||||||||| |||||| ||||| | ||| ||||||||||||||| |
|
|
| T |
51820507 |
ccatcaacaccactccgaaactatacacatcacttttctcattcactctatatgtgtaaccatattctgca |
51820577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University