View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11591_low_10 (Length: 241)
Name: NF11591_low_10
Description: NF11591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11591_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 74 - 224
Target Start/End: Original strand, 10507071 - 10507221
Alignment:
| Q |
74 |
taaagtccgtagcatccacgataaactgaacctcactaaacaaaagaataataattacacacgatacccactcaaacaccaaaaaagcataatctttgaa |
173 |
Q |
| |
|
|||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10507071 |
taaagtccgtggaatccacgataaactaaacctcactaaacaaaagaataataattacacacgatacccattcaaacaccaaaaaagcataatctttgaa |
10507170 |
T |
 |
| Q |
174 |
ttcatacatgatattattttgatttccctatcaagtttagtattaaataat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10507171 |
ttcatacatgatattattttgatttccctatcaagtttagtattaaataat |
10507221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University