View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11591_low_11 (Length: 240)
Name: NF11591_low_11
Description: NF11591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11591_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 44629418 - 44629650
Alignment:
| Q |
8 |
cagagatgatggaatagtttctctaacatcatggattaagtttgaaaacaacaacacaaatttctttcatcaaaggacttcccaacagaagaagagaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44629418 |
cagagatgatggaatagtttctctaacatcatggcttaagtttgaaaacaagaacacaaatttctttcatcaaaggacttcccaacagaagaagagaaaa |
44629517 |
T |
 |
| Q |
108 |
taggtggactctttcatgatttaatggcaatggtttagtaatacagtgctccaatcagcttggtatttgtcattttacatggcattcaagcttattgctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44629518 |
taggtggactctttcatgatttaatggcaatggtttagtaatacagtgctccaattagcttggtatttgtcattttacatggcattcaagcttattgctt |
44629617 |
T |
 |
| Q |
208 |
ccacaaaaacaaaggacggtggcttggcttgtt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44629618 |
ccacaaaaacaaaggacggtggcttggcttgtt |
44629650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University