View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11591_low_8 (Length: 290)
Name: NF11591_low_8
Description: NF11591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11591_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 3 - 267
Target Start/End: Original strand, 43407799 - 43408057
Alignment:
| Q |
3 |
aggaggagcagagaaagaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnn |
102 |
Q |
| |
|
||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407799 |
aggaggatctgagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggaggag |
43407898 |
T |
 |
| Q |
103 |
nnnnnnnnnatcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaactacgcc |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
43407899 |
gag------atcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgcc |
43407992 |
T |
 |
| Q |
203 |
acaatcacaatacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407993 |
acaatcacaatacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca |
43408057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University