View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11592_high_15 (Length: 340)
Name: NF11592_high_15
Description: NF11592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11592_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 22 - 329
Target Start/End: Complemental strand, 41059537 - 41059230
Alignment:
| Q |
22 |
tcgccgacaatttccgcgctctatcgtaagaatctaatcaaatcctccattgttttgatttccgcttcaaatttcttttccatgcatcgttttttgaatc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
41059537 |
tcgccgacaatttccgcgctctatcgtaagaatctaatcaaatcctccattgttttgatttccgcttcaaatttctctttcatgcatcgttttttgaatc |
41059438 |
T |
|
| Q |
122 |
gtcattgttgnnnnnnngtgcagaaatggatttcagaagctggagaaaattaaggatgcgagtagaaagagcaggcaattggaagaactcaccgagaaaa |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41059437 |
gtcattgttgattttttgtgcagaaatggatttcagaagctggagaaaattaaggatgcgagtagaaagagcaggcaattggaagaactcaccgagaaaa |
41059338 |
T |
|
| Q |
222 |
tgcgagaatgtaaagggtaatttttgtgtttcgttcgttatttgtgattgaaatgtttgttttttatgtcagccgatgaaagtttttgttacaatgttga |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41059337 |
tgcgagaatgtaaagggtaatttttgtgttttgttcgttatttgtgattgaaatgtttgttttttatgtcagccgatgaaagtttttgttacaatgttga |
41059238 |
T |
|
| Q |
322 |
gcttgatg |
329 |
Q |
| |
|
|||||||| |
|
|
| T |
41059237 |
gcttgatg |
41059230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University