View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11592_high_19 (Length: 284)
Name: NF11592_high_19
Description: NF11592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11592_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 5129558 - 5129285
Alignment:
| Q |
1 |
ttatggagcacgtcgttgtaagtggacgaataaatttgctaatgaacattttcacttgtttattatttttgttggctttgctccatatttattctgatct |
100 |
Q |
| |
|
||||||| ||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129558 |
ttatggaccacgtcgttgtaattgcacgaataaatttggcaatgaacattttcacttgtttattatttttgttggctttgctccatatttattctgatct |
5129459 |
T |
|
| Q |
101 |
attttgcaggccctcctcagaggctgcagctgctgagccactttcagtgataattccagtctcaaaatcgaaactcggaccatacagaactgttataatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129458 |
attttgcaggccctcctcagaggctgcagctgctgagccactttcagtgataattccagtctcaaaatcgaaactcggaccatacagaactgttataatc |
5129359 |
T |
|
| Q |
201 |
atgcgactcgtaatattgggtctgtttttccattatagagttacacatccagttgatagtgcttttggtctgtg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129358 |
atgcgactcgtaatattgggtctgtttttccattatagagttacacatccagttgatagtgcttttggtctgtg |
5129285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 171 - 266
Target Start/End: Complemental strand, 35927525 - 35927430
Alignment:
| Q |
171 |
aaactcggaccatacagaactgttataatcatgcgactcgtaatattgggtctgtttttccattatagagttacacatccagttgatagtgctttt |
266 |
Q |
| |
|
||||||| ||||||||||||||| ||||| |||| || ||||| |||||||| || ||||||||| |||||||| |||| ||||| ||||||||| |
|
|
| T |
35927525 |
aaactcgcaccatacagaactgtgataattgtgcggctagtaatcttgggtcttttcttccattatcgagttacaaatcctgttgaaagtgctttt |
35927430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University