View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11592_high_23 (Length: 250)

Name: NF11592_high_23
Description: NF11592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11592_high_23
NF11592_high_23
[»] chr3 (1 HSPs)
chr3 (8-243)||(45181037-45181272)


Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 45181272 - 45181037
Alignment:
8 gagcagagacaacgccggtactgcattacttgtcagtttagggaagacgaccctaccaccttgtttgagcaaaacaatggggacccctgaattgcagatg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45181272 gagcagagacaacgccggtactgcattacttgtcagtttagggaagacgaccctaccaccttgtttgagcaaaacaatggggacccctgaattgcagatg 45181173  T
108 gatgtgttggtgagcaacaaatatgcacagcattcacttcttttggtactaacaactctctatattgctaacaattagcagcaccttgtcctttcagact 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45181172 gatgtgttggtgagcaacaaatatgcacagcattcacttcttttggtactaacaactctctatattgctaacaattagcagcaccttgtcctttcagact 45181073  T
208 cgtttggttgggacttgtgtttcaagtttcatgttg 243  Q
    ||||||||||||||||||||||||||||||||||||    
45181072 cgtttggttgggacttgtgtttcaagtttcatgttg 45181037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University