View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11592_high_28 (Length: 213)
Name: NF11592_high_28
Description: NF11592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11592_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 101 - 202
Target Start/End: Original strand, 32902062 - 32902168
Alignment:
| Q |
101 |
tagtcacctaattctggttacacc-----atgacaaaaatatccataattaaaatttaattccaaatttcaccaaaataaaaccctttcaatcgttctct |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32902062 |
tagtcacctaattctggttacaccttgaaatgagaaaaatatccataattaaaatttaattcccaatttcaccaaaataaaaccctttcaatcgttctct |
32902161 |
T |
 |
| Q |
196 |
gcttctc |
202 |
Q |
| |
|
| ||||| |
|
|
| T |
32902162 |
gattctc |
32902168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University