View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11592_low_22 (Length: 267)
Name: NF11592_low_22
Description: NF11592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11592_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 143 - 249
Target Start/End: Original strand, 2582276 - 2582382
Alignment:
| Q |
143 |
ttggtttaaaatatatttgtccataaatataagcatctattgcgaatttcattcttattcagaaaaattaatagcagagttaatgtgtctattttatgca |
242 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2582276 |
ttggtttataatatatttgtccataaatataagcatctattctgaatttcattcttattcagaaaaattaatagcagagttaatgtatctattttatgca |
2582375 |
T |
|
| Q |
243 |
ttaatat |
249 |
Q |
| |
|
||||||| |
|
|
| T |
2582376 |
ttaatat |
2582382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 38 - 102
Target Start/End: Original strand, 2582218 - 2582282
Alignment:
| Q |
38 |
ggtaattggtttcgtaaaaagggaccgattgaaattcactttggctggtttggtggtgttggttt |
102 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2582218 |
ggtaattggtttagtaaaaagggacggattgaaattcactttggctggtttgaaggtgttggttt |
2582282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 109
Target Start/End: Original strand, 35053277 - 35053318
Alignment:
| Q |
67 |
tgaaattcactttggctggtttggtggtgttggtttgagatct |
109 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
35053277 |
tgaaattcacttggg-tggtttggtggtgttggtttgagatct |
35053318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University