View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11592_low_24 (Length: 250)
Name: NF11592_low_24
Description: NF11592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11592_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 45181272 - 45181037
Alignment:
| Q |
8 |
gagcagagacaacgccggtactgcattacttgtcagtttagggaagacgaccctaccaccttgtttgagcaaaacaatggggacccctgaattgcagatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45181272 |
gagcagagacaacgccggtactgcattacttgtcagtttagggaagacgaccctaccaccttgtttgagcaaaacaatggggacccctgaattgcagatg |
45181173 |
T |
 |
| Q |
108 |
gatgtgttggtgagcaacaaatatgcacagcattcacttcttttggtactaacaactctctatattgctaacaattagcagcaccttgtcctttcagact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45181172 |
gatgtgttggtgagcaacaaatatgcacagcattcacttcttttggtactaacaactctctatattgctaacaattagcagcaccttgtcctttcagact |
45181073 |
T |
 |
| Q |
208 |
cgtttggttgggacttgtgtttcaagtttcatgttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45181072 |
cgtttggttgggacttgtgtttcaagtttcatgttg |
45181037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University