View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11593_high_4 (Length: 220)

Name: NF11593_high_4
Description: NF11593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11593_high_4
NF11593_high_4
[»] chr5 (1 HSPs)
chr5 (18-207)||(22376832-22377021)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 22377021 - 22376832
Alignment:
18 gtgaactatgttgttgtgaagggacaatnnnnnnnngattggttacggtgtgcattgggggctaacaacacttgaaataaaattaacgttactacaaggg 117  Q
    ||||||||||||||||||||| ||||||        | |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
22377021 gtgaactatgttgttgtgaagcgacaataaaaaagaggttggttccggtgtgcattgggggctaacaacacttaaaataaaattaacgttactacaaggg 22376922  T
118 gaaacgagacggctgtaaaagaaatcaatgtgaaggtacattatattttttgtttaagattttgattcattaatcaccgtgtcttcttct 207  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22376921 gaaacgagacggctgcaaaagaaatcaatgtgaaggtacattatattttttgtttaagattttgattcattaatcaccgtgtcttcttct 22376832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University