View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11593_high_5 (Length: 211)
Name: NF11593_high_5
Description: NF11593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11593_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 114 - 200
Target Start/End: Original strand, 36625785 - 36625871
Alignment:
| Q |
114 |
ttacgatcgtttatgcaaaattccaaatagttttttacaacaaaagtccatatagttttttccagggaaagtccaaaaatagtttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36625785 |
ttacgatcgtttatgcaaaattccaaatagttttttacaacaaaagtccatatagttttttccagggaaagtccaaaaatagtttat |
36625871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University