View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11593_high_5 (Length: 211)

Name: NF11593_high_5
Description: NF11593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11593_high_5
NF11593_high_5
[»] chr3 (1 HSPs)
chr3 (114-200)||(36625785-36625871)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 114 - 200
Target Start/End: Original strand, 36625785 - 36625871
Alignment:
114 ttacgatcgtttatgcaaaattccaaatagttttttacaacaaaagtccatatagttttttccagggaaagtccaaaaatagtttat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36625785 ttacgatcgtttatgcaaaattccaaatagttttttacaacaaaagtccatatagttttttccagggaaagtccaaaaatagtttat 36625871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University