View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11593_low_5 (Length: 220)
Name: NF11593_low_5
Description: NF11593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11593_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 22377021 - 22376832
Alignment:
| Q |
18 |
gtgaactatgttgttgtgaagggacaatnnnnnnnngattggttacggtgtgcattgggggctaacaacacttgaaataaaattaacgttactacaaggg |
117 |
Q |
| |
|
||||||||||||||||||||| |||||| | |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22377021 |
gtgaactatgttgttgtgaagcgacaataaaaaagaggttggttccggtgtgcattgggggctaacaacacttaaaataaaattaacgttactacaaggg |
22376922 |
T |
 |
| Q |
118 |
gaaacgagacggctgtaaaagaaatcaatgtgaaggtacattatattttttgtttaagattttgattcattaatcaccgtgtcttcttct |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22376921 |
gaaacgagacggctgcaaaagaaatcaatgtgaaggtacattatattttttgtttaagattttgattcattaatcaccgtgtcttcttct |
22376832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University