View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11594_low_14 (Length: 302)
Name: NF11594_low_14
Description: NF11594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11594_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 41387007 - 41387140
Alignment:
| Q |
17 |
tgaatcttgattaaaatttaaagaaaagagcattgctattgaccgtgacaaagtttatcttgaatgtatcacgaacatgtttcaaccaaatagaattctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41387007 |
tgaatcttgattaaaatttaaagaaaagagcattgctattgaccgtgacaaagtttatcttgaatgtatcacgaacatgtttcaaccaaatagaattctt |
41387106 |
T |
 |
| Q |
117 |
gttggccagaaatcaaagtaaacaatagatataa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41387107 |
gttggccagaaatcaaagtaaacaatagatataa |
41387140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 142 - 282
Target Start/End: Original strand, 41387611 - 41387754
Alignment:
| Q |
142 |
tagatataatttagaaaaggtatcaagcaatcatacggtccggaaattttcgtgataatatccttcgttacaactatcatttcccattgttttattttga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41387611 |
tagatataatttagaaaaggtatcaagcaatcatacggtcggaaaattttcgtgaaaatatccttcgttacaactatcatttcccattgttttattttga |
41387710 |
T |
 |
| Q |
242 |
gcaatgc---attaatgcaactcattcctagtaaagagtgcata |
282 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
41387711 |
gcaatgcaagattaatgcaactcattcgtagtaaagagtgcata |
41387754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University