View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11596_high_15 (Length: 242)
Name: NF11596_high_15
Description: NF11596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11596_high_15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 11665275 - 11665499
Alignment:
| Q |
20 |
gacatgattatgataatatgcattatcttatgttagagattatgagggtggaattattgttaatt--aaggagacaaaggttataactatagtgatcttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
11665275 |
gacatgattatgataatatgcattatcttatgttagagattataagggtggaattattgttaattgtaaggagacaaaggttataactagagtgatcttt |
11665374 |
T |
|
| Q |
118 |
aaaacacttgccatgccaaatatgggaaatatttagactcttttgattcaaaattttgagactggtactataggtatgtactataatcatgattcaaaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11665375 |
aaaacacttgccatgccaaatatgggaaatatttaggctcttttgattcaaaattttgagactggtactataggtatgtactataatcatgattcaaaac |
11665474 |
T |
|
| Q |
218 |
cctctcgtaattttttcctccttct |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
11665475 |
cctctcgtaattttttcctccttct |
11665499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University