View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11596_low_6 (Length: 464)

Name: NF11596_low_6
Description: NF11596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11596_low_6
NF11596_low_6
[»] chr3 (3 HSPs)
chr3 (318-454)||(44852535-44852669)
chr3 (19-69)||(44852919-44852969)
chr3 (199-235)||(44852752-44852788)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 318 - 454
Target Start/End: Complemental strand, 44852669 - 44852535
Alignment:
318 ggcaagcttcgtttatctttaaatttagatgtactactgtgttttatacggaaactaannnnnnnnnnnnctgcatttggttcatgtgaaatcattgcat 417  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||    
44852669 ggcaagcttcgtttatctttaaatttagatgtactactgtgttttatacggaaactaa--aatattttttctgcatttggttcatgtgaaatcattgcat 44852572  T
418 acannnnnnngttggctgtgttggtctctaacctatg 454  Q
    |||       |||||||||||||||||||||||||||    
44852571 acatttttttgttggctgtgttggtctctaacctatg 44852535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 44852969 - 44852919
Alignment:
19 gattctgtgttcaaagatgatgtggtttgtgtctttttcatgcttctgtta 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
44852969 gattctgtgttcaaagatgatgtggtttgtgtctttttcatgcttctgtta 44852919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 199 - 235
Target Start/End: Complemental strand, 44852788 - 44852752
Alignment:
199 attggttctgatgaaacagtgtaaaaataagctaggg 235  Q
    |||||||||||||||||||||||||||||||||||||    
44852788 attggttctgatgaaacagtgtaaaaataagctaggg 44852752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University