View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11596_low_6 (Length: 464)
Name: NF11596_low_6
Description: NF11596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11596_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 318 - 454
Target Start/End: Complemental strand, 44852669 - 44852535
Alignment:
| Q |
318 |
ggcaagcttcgtttatctttaaatttagatgtactactgtgttttatacggaaactaannnnnnnnnnnnctgcatttggttcatgtgaaatcattgcat |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44852669 |
ggcaagcttcgtttatctttaaatttagatgtactactgtgttttatacggaaactaa--aatattttttctgcatttggttcatgtgaaatcattgcat |
44852572 |
T |
|
| Q |
418 |
acannnnnnngttggctgtgttggtctctaacctatg |
454 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |
|
|
| T |
44852571 |
acatttttttgttggctgtgttggtctctaacctatg |
44852535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 44852969 - 44852919
Alignment:
| Q |
19 |
gattctgtgttcaaagatgatgtggtttgtgtctttttcatgcttctgtta |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44852969 |
gattctgtgttcaaagatgatgtggtttgtgtctttttcatgcttctgtta |
44852919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 199 - 235
Target Start/End: Complemental strand, 44852788 - 44852752
Alignment:
| Q |
199 |
attggttctgatgaaacagtgtaaaaataagctaggg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44852788 |
attggttctgatgaaacagtgtaaaaataagctaggg |
44852752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University