View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_high_19 (Length: 408)
Name: NF11599_high_19
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 327; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 61 - 407
Target Start/End: Complemental strand, 36333879 - 36333533
Alignment:
| Q |
61 |
gagagtaatatgctgctttatggtttccaacccctgttgtggtgcctgcagatattaatttagaaataatggattgtgttgctacacttttgaattaatg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333879 |
gagagtaatatgctgctttatggtttccaacccctgttgtggtgcctgcagatattaatttggaaataatggattgtgttgctacacttttgaattaatg |
36333780 |
T |
 |
| Q |
161 |
ttgaagaaattgatcctgccctagagatggtctaaaggaaaagtcatgaccctttgtaggtttgctgtctcaatttttcaccatcaagttctcagtattg |
260 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333779 |
ttgaagtaattgatcctgccctagagatggtctaaaggaaaagtcatgaccctttgtaggtttgctgtctcaatttttcaccatcaagttctcagtattg |
36333680 |
T |
 |
| Q |
261 |
tgaagtaatccgtgtcattttgtcaaaattctgcattgttgtgtacaacaatgatatagtatatttataataggtgttgtagtttgttggtttttgttat |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
36333679 |
tgaagtaatccgtgtcattttgtcaaaattctgcattgttgtgtacaacaatgatatagcatatttataaaaggttttgtagtttgttggtttttgttat |
36333580 |
T |
 |
| Q |
361 |
tggataagatgaataatttgagaaaaatgagttttacccttctgtgc |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333579 |
tggataagatgaataatttgagaaaaatgagttttacccttctgtgc |
36333533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 6 - 34
Target Start/End: Complemental strand, 36333937 - 36333909
Alignment:
| Q |
6 |
aattgaaacaaggaaataatgaggcacct |
34 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36333937 |
aattgaaacaaggaaataatgaggcacct |
36333909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University