View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_high_46 (Length: 261)
Name: NF11599_high_46
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 20713943 - 20713774
Alignment:
| Q |
16 |
atgaatagacttttcacccatccaaaccagctcttcctctttgccatgaagttttttcacataccatttttattcatcaaacacatcctatacttgatct |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713943 |
atgaatagacttttcacccagccaaaccagctcttcctctttgccatgaagttttttcacataccatttttattcatcaaacacatcctatacttgatct |
20713844 |
T |
|
| Q |
116 |
tcaagaaagaagagaaaagtgataagtaacattgattttttatttcaaaatggaaaaataagcacttgtg |
185 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20713843 |
tcaagaaagaagaggaaagtgataagtaacattgattttttatttaaaaatggaaaaataagcacttgtg |
20713774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 245
Target Start/End: Complemental strand, 20713673 - 20713642
Alignment:
| Q |
214 |
tttcgaaaatcatttattgtttatataaaaac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20713673 |
tttcgaaaatcatttattgtttatataaaaac |
20713642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University