View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_high_50 (Length: 252)
Name: NF11599_high_50
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 34681749 - 34681977
Alignment:
| Q |
19 |
ctatcttgaagaattattcgatcaagatcgacaagttttgtttttggatctgcgctcttctgtttctgtggagcatccgtgttggttctgttttggtgtc |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34681749 |
ctatcttgaagaattattcaatcaagatcgacaagttttgtttttggatctgcgctcttctgtttctgtggagcattcgtgttggttctgttttggtgtc |
34681848 |
T |
|
| Q |
119 |
tat--------cgcagggactttctatagtaggagctcgagtttcaacaaattcggtgcatacatacatcagctatcacaagaagttaggaactattttc |
210 |
Q |
| |
|
||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34681849 |
tatttgatggccgcagggactttctatcgtgggagctcgagtttcaacaaattcggtgcatacatacatcagctatcacaagaagttaggaactattttc |
34681948 |
T |
|
| Q |
211 |
acaaatttgcatcatccgttctagtccct |
239 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
34681949 |
acaaatttgtgtcatccgttctagtccct |
34681977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 121
Target Start/End: Original strand, 10831560 - 10831628
Alignment:
| Q |
52 |
agttttgtttttggatctgcgctcttctgtttctgtggagcatccgtgttggttctgttttggtgtctat |
121 |
Q |
| |
|
|||||||||||||| |||| ||||||| || ||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
10831560 |
agttttgtttttggtgctgcactcttctctt-ctgtggaacatccatgttggttctgttttggagtctat |
10831628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University