View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_high_55 (Length: 240)
Name: NF11599_high_55
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36274128 - 36274350
Alignment:
| Q |
1 |
tgaaatatagtgctatccaattactacttgaactattgtcgatatcttttcttcaagattttatcgactatggcattggcttcacttttaaaatacatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36274128 |
tgaaatatagtgctatccaattactacttgaactattgtcgatatcttttcttcaagattttatcgactatggcattggcttcacttttaaaatacatga |
36274227 |
T |
 |
| Q |
101 |
ttctgttcatacttgtgctgagatagttgcatgggaagaatgcaaacgtgcaccatactcctctgaagataggtttccagtctttgttcgacatttatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36274228 |
ttctgttcatacttgtgctgagatagttgcatgggaagaatgcaaacgtgcaccatactcctctgaagataggtttccagtctttgttcgacatttaact |
36274327 |
T |
 |
| Q |
201 |
ttccctgaaaacaaagaactcga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36274328 |
ttccctgaaaacaaagaactcga |
36274350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 102
Target Start/End: Original strand, 40221700 - 40221774
Alignment:
| Q |
28 |
ttgaactattgtcgatatcttttcttcaagattttatcgactatggcattggcttcacttttaaaatacatgatt |
102 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||| | |||| |||||||| || | |||||| ||||||||| |
|
|
| T |
40221700 |
ttgaactgttgtcaatatcttttcttcaagattttgttgactgcggcattggatttgcgtttaaagtacatgatt |
40221774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University