View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_high_66 (Length: 231)
Name: NF11599_high_66
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_high_66 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 128 - 215
Target Start/End: Complemental strand, 41504474 - 41504387
Alignment:
| Q |
128 |
atgccgttgtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttg |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41504474 |
atgccgtggtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttg |
41504387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 41504529 - 41504473
Alignment:
| Q |
1 |
gtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41504529 |
gtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat |
41504473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University