View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11599_high_66 (Length: 231)

Name: NF11599_high_66
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11599_high_66
NF11599_high_66
[»] chr2 (2 HSPs)
chr2 (128-215)||(41504387-41504474)
chr2 (1-57)||(41504473-41504529)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 128 - 215
Target Start/End: Complemental strand, 41504474 - 41504387
Alignment:
128 atgccgttgtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttg 215  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41504474 atgccgtggtcgttggtacttcatgtatactcgagtatggcagttagttaggaataagaaaaaagacaataaagatagaagttgcttg 41504387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 41504529 - 41504473
Alignment:
1 gtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat 57  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41504529 gtgtaggttagatgattaaatatgctaccagcccctaccacaaatactagtactcat 41504473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University