View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_high_68 (Length: 214)
Name: NF11599_high_68
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_high_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 201
Target Start/End: Complemental strand, 37324772 - 37324576
Alignment:
| Q |
5 |
ggaccaaaaccaagcatggtatttgtagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtggccatggacgatccattgacgg |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37324772 |
ggaccaaaaccaagcatggtatttatagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtggccatggacgatccattgacgg |
37324673 |
T |
|
| Q |
105 |
ctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggactaatgatggtgatgtccat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37324672 |
ctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacttctatatcacaagaggagatgggactaatgatggtgatgaccat |
37324576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 37317216 - 37317016
Alignment:
| Q |
1 |
gtcaggaccaaaaccaagcatggtatttgtagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtggccatggacgatccattg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||| |
|
|
| T |
37317216 |
gtcaggaccaaaacctagcatggtatttgtagctgagcccaatggcaaggtaaaaaatgcgttgccattcgggaccgttgtggccatggatgacccattg |
37317117 |
T |
|
| Q |
101 |
acggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggactaatgatggtgatgtcca |
200 |
Q |
| |
|
|| ||||| || |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37317116 |
actgctggtcctgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacttcaatatcacaagaggagatgggactaatgatggtgatgacca |
37317017 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
37317016 |
t |
37317016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 37320795 - 37320595
Alignment:
| Q |
1 |
gtcaggaccaaaaccaagcatggtatttgtagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtggccatggacgatccattg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||| ||||| || || ||| |
|
|
| T |
37320795 |
gtcaggaccaaaacctagcatggtatttgtagctgagcccaatggcaaggtaaaaaatgccttgccattcgggacagttgtggcgatggatgaccccttg |
37320696 |
T |
|
| Q |
101 |
acggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggactaatgatggtgatgtcca |
200 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37320695 |
acggctggacccgaacgtgaatcaaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggactaatgatggtgatgacca |
37320596 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
37320595 |
t |
37320595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 65 - 192
Target Start/End: Complemental strand, 37306807 - 37306680
Alignment:
| Q |
65 |
ccattcgggacggttgtggccatggacgatccattgacggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatat |
164 |
Q |
| |
|
||||||||||| || ||||||||||| ||||| |||||| |||||| |||| |||||||||||| |||||||| ||||||||||||||| | |||| |
|
|
| T |
37306807 |
ccattcgggacagtggtggccatggatgatccgttgacgattgggcctgaacttgactcgaaactcgtgggtaaagctcaaggaatttacgctgtaatat |
37306708 |
T |
|
| Q |
165 |
cacaagaggagatgggactaatgatggt |
192 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
37306707 |
cacaagatgagatgggactaatgatggt |
37306680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University