View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_low_17 (Length: 447)
Name: NF11599_low_17
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 211 - 443
Target Start/End: Original strand, 22777736 - 22777968
Alignment:
| Q |
211 |
tttggatctgttacaggttccggaacataattagtatgaaaatcatttttccttggctgtctggtatcaatctttcaatattgggaccactacaagtaat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22777736 |
tttggatctgttacaggttccggaacataattagtatgaaaatcatttttccttggctgtctggtatcaatctttcaatattgggaccactacaagtaat |
22777835 |
T |
 |
| Q |
311 |
tttttccaaggagacgatgagcctcaaccttgagagaattataagattcctagtagccataatatttccacaatcacgacctggcctgatggtattgttt |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22777836 |
tttttccaaggagacgatgagcctcaaccttgagagaattataagattcctagtagccataatatttccacaatcacgacctggcctgatggtattgttt |
22777935 |
T |
 |
| Q |
411 |
gccagtaacaatcagttcatacttcatctcact |
443 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
22777936 |
gccagtaacaatcagttcatacttcatatcact |
22777968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 22777667 - 22777739
Alignment:
| Q |
1 |
tgaaatctattacttctttgatgttcttatgtttgatgaaaacttgaaagtctttaaaagttggtaacttttg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22777667 |
tgaaatctattacttctttgatgttcttatgtttgatgaaaacttgaaagtctttaaaagttggtaacttttg |
22777739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University