View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11599_low_29 (Length: 350)

Name: NF11599_low_29
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11599_low_29
NF11599_low_29
[»] chr7 (1 HSPs)
chr7 (289-336)||(22777643-22777690)


Alignment Details
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 289 - 336
Target Start/End: Original strand, 22777643 - 22777690
Alignment:
289 tttttcgctatagtgtgaatattgtgaaatctattacttctttgatgt 336  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
22777643 tttttcgctatagtgtgaatattgtgaaatctattacttctttgatgt 22777690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University