View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_low_35 (Length: 329)
Name: NF11599_low_35
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 15 - 176
Target Start/End: Complemental strand, 24725642 - 24725478
Alignment:
| Q |
15 |
caaaggagcatttaagtta--gcagagagacaaaacaaatgattttgcctccattcattatagtcgaagtcaaaggaataatatgggttgattgaatgca |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| ||| |||||| |
|
|
| T |
24725642 |
caaaggagcatttaagttacagcagagagacagaacaaatgattttgcctccattcattatagtggaaatcaaaagaataatatgggttcattcaatgca |
24725543 |
T |
 |
| Q |
113 |
tccaacatttt-nnnnnnncaacagatatttttgggatgaaatccaattgatcacttctttttat |
176 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24725542 |
tccaacattttaaaaaatacaacaaatatttttgggatgaaatccaattgatgacttctttttat |
24725478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 262 - 311
Target Start/End: Complemental strand, 24725388 - 24725339
Alignment:
| Q |
262 |
aatgttcatgtttctattaacgggttaaaatgatatgaatgtgattgctt |
311 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24725388 |
aatgttcatgtttctattaactggttaaaatgatatgaatgtgattgctt |
24725339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 15 - 90
Target Start/End: Complemental strand, 15134758 - 15134681
Alignment:
| Q |
15 |
caaaggagcatttaagtta--gcagagagacaaaacaaatgattttgcctccattcattatagtcgaagtcaaaggaa |
90 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||| |||||| ||||||||||||| | || ||||| ||| ||||||||| |
|
|
| T |
15134758 |
caaaagagcaattaagttacagcagagagacagaacaaaggattttgcctccactgatcatagtggaaatcaaaggaa |
15134681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University