View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_low_36 (Length: 319)
Name: NF11599_low_36
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 37662670 - 37662371
Alignment:
| Q |
1 |
agaaccataaccaaaacttgatgaatctttcagaatcccttcaagaacagaatgcaatgcagttgaaaatgaagaatacccttttgaaccaagtaactga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662670 |
agaaccataaccaaaacttgatgaatctttcagaatcccttcgagaacagaatgcaatgcagttgaaaatgaagaatacccttttgaaccaagtaactga |
37662571 |
T |
 |
| Q |
101 |
acaaccttgttccattcaacaaagttcttgaaatcaccaacttcatatgttgaatttgtcttgaatgaaggacaagttggtgaacgaatgaaatcagaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662570 |
acaaccttgttccattcaacaaagttcttgaaatcaccaacttcatatgttgaattggttttgaatgaaggacaagttggtgaacgaatgaaatcagaac |
37662471 |
T |
 |
| Q |
201 |
caccttgtaaaacttcacgttgcaaagaagaaaaaggtccaagaacaccatgaatgttgaattcttcaccaagaaacatatcagggtttgatatcaaaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662470 |
caccttgtaaaacttcacgttgcaaagaagaaaaaggtccaagaacaccatgaatgttgaattcttcaccaagaaacatatcagggtttgatatcaaaac |
37662371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University