View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_low_39 (Length: 304)
Name: NF11599_low_39
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 100 - 206
Target Start/End: Complemental strand, 14431052 - 14430946
Alignment:
| Q |
100 |
cggtgatggcttatcctccacctggaatggcggcagcggggtctagctcggtgccgtatggtacaccttatcctcctcagctgcaacaaccggtttatgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
14431052 |
cggtgatggcttatcctccacctggaatggcggcagctgggtctagctcggtgccgtatggtacaccttatcctcctcagccgcaacaaccgggttatgg |
14430953 |
T |
|
| Q |
200 |
atatcca |
206 |
Q |
| |
|
||||||| |
|
|
| T |
14430952 |
atatcca |
14430946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 14431179 - 14431097
Alignment:
| Q |
18 |
agaacgtcttcggggaaagctaaagggaacttaaacctctcttacaaattcggcgaaaaagtcaaagctctggggacgaaaac |
100 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| || || |||||| |
|
|
| T |
14431179 |
agaacatcttcagggaaagctaaaggaaacttaaacctctcttacaaattcggcgaaaaagtccaagctccggcgatgaaaac |
14431097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 14430775 - 14430734
Alignment:
| Q |
182 |
gcaacaaccggtttatggatatccagtggcagaagcacagaa |
223 |
Q |
| |
|
||||||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
14430775 |
gcaacaaccgggttatggatatccaggggcacaagcacagaa |
14430734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University