View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11599_low_73 (Length: 217)
Name: NF11599_low_73
Description: NF11599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11599_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 37324301 - 37324094
Alignment:
| Q |
1 |
aaactctcacccaatgtgaaaggcaaaccaatgaaataaacattgtaataccacgttggttattaaattcagtatacatttttaatttttgtcactttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
37324301 |
aaactctcacccaatgtgaaaggcaaaccgatgaaataaacattgtaataccacattggttattaaattcagtatacattgttaattattgtcactttaa |
37324202 |
T |
|
| Q |
101 |
tataccactaaagaa----atatcttcagactcattatagtgtttcctccaaagggacaaaggaccattatttgaattgctagcattgtgacttgtgagt |
196 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37324201 |
tataccactaaagaaatagatatcttcagactcattatagtgtttcctccaaagggacaaaggaccattatttgaattgctagcattgtgacttgtgagt |
37324102 |
T |
|
| Q |
197 |
ctcgtgat |
204 |
Q |
| |
|
|||||||| |
|
|
| T |
37324101 |
ctcgtgat |
37324094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University