View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_high_13 (Length: 361)
Name: NF1159_high_13
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 3 - 332
Target Start/End: Complemental strand, 7798555 - 7798226
Alignment:
| Q |
3 |
gaaactcttcggaaacaaatcgcagcttattctgtaatctctgaacaactcattcaaacacataaaaccttatcttctcaacaagatctcactctcactg |
102 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7798555 |
gaaactcttcggaaacaaatagcagtttattctgtaatctctgagcaactcattcaaacacataaaaccttatcttctcaacaagatctcaccctcactg |
7798456 |
T |
 |
| Q |
103 |
gtaagtttgttacagttttgtagtttagttactcattctcaacggtatcacagttaaccgggtggagcccggttcaatattatgaaccgggtctttggta |
202 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7798455 |
gtaagtttgttacagattcgtagtttagttactcattctcaaaggtatcacagttaaccgggtggagcccggttcaatattatgaaccgggtctttggta |
7798356 |
T |
 |
| Q |
203 |
cggtttggtatattacgaatgtgttttagttgaatattattaaaatagattaaataaattgtaatcaacatttaataatgatttttagggtctactaggc |
302 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7798355 |
cggtttggtttattaggaatgtgttttagttgaatattattaaaatagattaaataaattgtaatcaacatttaataatgatttttagggtctactaggc |
7798256 |
T |
 |
| Q |
303 |
tgaggcagcgttggacaccaacacctgtgc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7798255 |
tgaggcagcgttggacaccaacacctgtgc |
7798226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University