View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_high_34 (Length: 251)
Name: NF1159_high_34
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_high_34 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 79 - 251
Target Start/End: Complemental strand, 673939 - 673770
Alignment:
| Q |
79 |
aatttgaaatataaaaatcaatggcgttggtatctgtgnnnnnnnnncatcaatggtgttggtagacgaaggtgtgtgtgccattgccacgaaattaaat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
673939 |
aatttgaaatataaaaatcaatggcgttggtatctgtggaaaaaaa-catcaatggtgttggtagacgaaggtgtgtgtggcattgccacgaaat----- |
673846 |
T |
|
| Q |
179 |
gcaaagaggttgaaagggatg---gaactgatgctatgcaatgctcctgatttaaccacatttaggaattatcagt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
673845 |
gcaaagaggttgaaagggatgaatgaactgatgctatgcaatgctcctgatttaacaacatttaggaattatcagt |
673770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 80
Target Start/End: Complemental strand, 41838340 - 41838310
Alignment:
| Q |
50 |
atcaacaaaaaggttactattaatcaaacaa |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41838340 |
atcaacaaaaaggttactattaatcaaacaa |
41838310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University