View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_high_6 (Length: 503)
Name: NF1159_high_6
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 115 - 453
Target Start/End: Original strand, 34224857 - 34225199
Alignment:
| Q |
115 |
aagaagatgggtttaactgaacctaaggttgttactggtcctgctggttatgtacttgaagatgttcctcacttgtctgattacattcctgatcttcctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34224857 |
aagaagatgggtttaactgaacctaaggttgttactggtcctgctggttatgtacttgaagatgttcctcacttgtctgattacattcctgatcttcctg |
34224956 |
T |
 |
| Q |
215 |
tacg--nnnnnnnnnnnnnnnnnagcttttttctcaagctactattcatggtcaatgattaatcatgtttaac--nnnnnnnnctgtaatgtttgtctta |
310 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34224957 |
tacgtctctctctctctctctctagcttttttctcaagctactattcatggtcaatgattaatcatgtttaacttttttttttctgtaatgtttgtctta |
34225056 |
T |
 |
| Q |
311 |
ataattaaaaaatataagatacttttaatattctttttctttctgccgacagtaaattattattattaattatgttggattattggtgnnnnnnnnnnnn |
410 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225057 |
ataattaaaaaataaaagatacttttaatattctttttctttctgccgacagtaaattattattattaattatgttggattattggtgttttttgttttt |
34225156 |
T |
 |
| Q |
411 |
nnatctgctaacagatcagatatgaataatttggttatgccac |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225157 |
ttatctgctaacagatcagatatgaataatttggttatgccac |
34225199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 43299936 - 43299889
Alignment:
| Q |
169 |
cttgaagatgttcctcacttgtctgattacattcctgatcttcctgta |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
43299936 |
cttgaggatgttcctcacttgtctgattacatacctgatctccctgta |
43299889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University