View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_low_17 (Length: 355)
Name: NF1159_low_17
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_low_17 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 102 - 240
Target Start/End: Complemental strand, 91149 - 91011
Alignment:
| Q |
102 |
tggggtgaatttcagaatcgtttgacattgcaccatccttgatttctacgatggcacacacgatattgtccgatccaagctaaatacaattctaggcacg |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91149 |
tggggtgaatttcagagtcgtttgacattgcacatcccttgatttctacgatggcacacacaatattgtccgatccaagctaaatacaattctaggcacg |
91050 |
T |
|
| Q |
202 |
cgatagattggaagggacggctcagattgtattacccta |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91049 |
cgatagattggaagggacggctcagattgtattacccta |
91011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 102 - 240
Target Start/End: Original strand, 6640323 - 6640462
Alignment:
| Q |
102 |
tggggtgaatttcagaatcgtttgacattgcaccatcc-ttgatttctacgatggcacacacgatattgtccgatccaagctaaatacaattctaggcac |
200 |
Q |
| |
|
||||||||||| |||||| |||||| ||||||| |||| |||||||||||||| | ||| |||||| ||||||||||||| |||||||||||| ||| |
|
|
| T |
6640323 |
tggggtgaattccagaattgtttgagattgcactatcccttgatttctacgatctcgcacgcgatatcgtccgatccaagccaaatacaattctgcacac |
6640422 |
T |
|
| Q |
201 |
gcgatagattggaagggacggctcagattgtattacccta |
240 |
Q |
| |
|
||| |||||||||||||||| || |||| ||||||||||| |
|
|
| T |
6640423 |
gcggtagattggaagggacgactgagatcgtattacccta |
6640462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University