View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_low_21 (Length: 334)
Name: NF1159_low_21
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 92 - 324
Target Start/End: Complemental strand, 32339080 - 32338848
Alignment:
| Q |
92 |
gatatggatgtcatattgttatgcacatctatttcatcactatctgaggttgtcggatcgatgccactcgcttgtctgaagcgaccaacactttttgttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32339080 |
gatatggatgtcatattgttatgcacatctatttcatcactatctgaggttgtcggatcgatgccactcgcttgtctgaagcgaccaacactttttgttg |
32338981 |
T |
 |
| Q |
192 |
atgttctttcagtcaaagagcacccaaagaaccttctattaaaggtatacagtttattagggtgatggtagtacttttctttacttgtttcattcagata |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
32338980 |
atgttctttcagtcaaagagcacccaaagaaccttctattaaaggtatgcagtttattagggtgatggtggtatttttctttacttgtttcattcagata |
32338881 |
T |
 |
| Q |
292 |
attgatgtagtttctgtttcaatatttcctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32338880 |
attgatgtagtttctgtttcaatatttcctatg |
32338848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 36054687 - 36054646
Alignment:
| Q |
177 |
caacactttttgttgatgttctttcagtcaaagagcacccaa |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
36054687 |
caacactctttgttgatgttctttcagtcaaagaacacccaa |
36054646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University