View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_low_30 (Length: 296)
Name: NF1159_low_30
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 37975429 - 37975310
Alignment:
| Q |
1 |
aaccaccaccatgaccataacctgaattcactacatcatcataatgatgcacatgatcattttgcaccatattcatcgacccattttgttgattttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37975429 |
aaccaccaccatgaccataacctgaattcactacatcatcatgatgatgcacatgatcattttgcaccatagtcatcgacccattttgttgattttgatt |
37975330 |
T |
|
| Q |
101 |
cagtttcttcctttgcttct |
120 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
37975329 |
cagtttcttccttttcttct |
37975310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University