View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_low_31 (Length: 293)
Name: NF1159_low_31
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 10142333 - 10142481
Alignment:
| Q |
1 |
aaataccaaccatgtaagaaaactggtcgtggaaccataattcaatttcaatacataattatcgcagttttaattagtctgtgtttcaagttgagtttgt |
100 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10142333 |
aaataccaatcatgtaagaaaactgt--gtggaaccataattcaatttcaatacacaattatcgcagttttaattagtctgtgtttcgagttgagtttgt |
10142430 |
T |
|
| Q |
101 |
ttaattgttctgccccaagatttaagaattattcttttgtcgtagttatgt |
151 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10142431 |
ttaattgttctgccccaagatttatgaattattcttttgtcgtagttatgt |
10142481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University