View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_low_36 (Length: 267)
Name: NF1159_low_36
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 46 - 231
Target Start/End: Complemental strand, 43439527 - 43439339
Alignment:
| Q |
46 |
gtatcatcaatggcatgctattttgatttgaaaagtaattagctgtatctgtaaattgatttg---aagtgaacaaattgtccaagcttttccaatcaat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43439527 |
gtatcatcaatggcatgctattttgatttgaaaagtaattagctgtatctgtaaattgatttgttgaagtgaacaaattgtccaagcttttccaatcaat |
43439428 |
T |
|
| Q |
143 |
tacttgtccattgttattattaatattattgctcctttcttcactgcaatattcttcaattgtgagtccattgtgatgagtatattctt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43439427 |
tacttgtccattgttattattaatattattgctcctttcttcactgcaatattcttcaattgtgagtccattgtgatgagtattttctt |
43439339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University