View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1159_low_49 (Length: 218)
Name: NF1159_low_49
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1159_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 13144126 - 13144013
Alignment:
| Q |
1 |
aattatgggccctccaattgtgaaccattttgttgttaaagttaggtgtgacaatctgcatatgtctctcaaaaagcgtctttaatgtgtcgtttggctc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
13144126 |
aattacgggccctccaattgtgaaccattttgttgttaaagttaggtgtgacaatctgcatatgtctctcaaaaagcgtcttcaatgtgtcgtttcgctc |
13144027 |
T |
|
| Q |
101 |
ttgaatcggtaaac |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13144026 |
ttgaatcggtaaac |
13144013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University