View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11601_high_11 (Length: 216)
Name: NF11601_high_11
Description: NF11601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11601_high_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 42169910 - 42169710
Alignment:
| Q |
16 |
gaacaaaaaacggacctgtttgcagactgtgttataaagatctttcggggaaactccaccctgcacaagctggttaaacacatcatcacaagattttgaa |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42169910 |
gaacgaaaaacggacctgtttgcagactgtgttataaagatctttcggggaaactccaccctgcacaagctggttaaacacatcatcacaagattttgaa |
42169811 |
T |
 |
| Q |
116 |
atttgtgccatattccctcctttacgaaccctgtgaaaatgtaatttctgttagagattaccattaccctacgtaggccctgtttggataaacaacttaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42169810 |
atttgtgccatattccctcctttacgaaccctgtgaacatgtaatttctgttagagattaccattaccctacgtaggccctgtttggataaacaacttaa |
42169711 |
T |
 |
| Q |
216 |
t |
216 |
Q |
| |
|
| |
|
|
| T |
42169710 |
t |
42169710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University