View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11602_high_20 (Length: 302)
Name: NF11602_high_20
Description: NF11602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11602_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 30 - 291
Target Start/End: Complemental strand, 10239542 - 10239281
Alignment:
| Q |
30 |
gcttattggtttagcggcacgtggatccgtggctgtagcacgtgtgttaactggtcagtataatccaattaacggcattggattgatcaacacaagtttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10239542 |
gcttattggtttagcggcacgtggatccgtggctgtagcacgtgtgttaactggtcagtataatccaattaacggcattggattgatcaacacaagtttg |
10239443 |
T |
|
| Q |
130 |
gctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacaccaaacggtgatatccaaacaatcggccgttatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10239442 |
gctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacaccaaacggtgatatccaaacaataggccgttatg |
10239343 |
T |
|
| Q |
230 |
attttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacacaggt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10239342 |
attttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacacaggt |
10239281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 30 - 288
Target Start/End: Complemental strand, 10230762 - 10230504
Alignment:
| Q |
30 |
gcttattggtttagcggcacgtggatccgtggctgtagcacgtgtgttaactggtcagtataatccaattaacggcattggattgatcaacacaagtttg |
129 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||| |||||||| ||||||||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10230762 |
gcttattgctttagcggcacgtggatccgtggttgtagcacgggtgttaaccggtcagtataacccatctaacggcattggattggtcaacacaagttta |
10230663 |
T |
|
| Q |
130 |
gctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacaccaaacggtgatatccaaacaatcggccgttatg |
229 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
10230662 |
gctctgtttggtaaccgtctttttgctttaggagaatcagatcttccttatgaagtcaaactaacaccaaacggtgacatccaaacaatgggccgttatg |
10230563 |
T |
|
| Q |
230 |
attttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacaca |
288 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
10230562 |
atttcaacggcaaactcttgatgagtatgacggcgcatcctaaaatagactctgacaca |
10230504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 99 - 291
Target Start/End: Original strand, 10255132 - 10255324
Alignment:
| Q |
99 |
taacggcattggattgatcaacacaagtttggctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacacca |
198 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
10255132 |
taacggcattggtttagccaacacaagtttggctctgtttggtaacaaactttttgctttaggagaatcagatcttccttatgaaatcaatcttacgcca |
10255231 |
T |
|
| Q |
199 |
aacggtgatatccaaacaatcggccgttatgattttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacacaggt |
291 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||| ||||| |||||| || ||||| ||||||||| |||||||||| |
|
|
| T |
10255232 |
aacggtgatatccaaacaattggccgttatgattttaacggtaaactctccatgagtatgactgcacatccgaaaattgacggcgacacaggt |
10255324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University