View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11602_low_1 (Length: 537)
Name: NF11602_low_1
Description: NF11602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11602_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 2e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 191 - 314
Target Start/End: Original strand, 43513658 - 43513781
Alignment:
| Q |
191 |
gtctcggagaagcataagccgttctgaacgagacagggagagagaacgggaggagagagataggtctcggaggagtagaagtcgttctgagcgcgatttt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513658 |
gtctcggagaagcataagccgttctgaacgagacagggagagagaacgggaggagagagataggtctcggaggagtagaagtcgttctgagcgcgatttt |
43513757 |
T |
 |
| Q |
291 |
gaaatgagagatagccggtaacgt |
314 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43513758 |
gaaatgagagatagccggtaacgt |
43513781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 410 - 521
Target Start/End: Original strand, 43513877 - 43513988
Alignment:
| Q |
410 |
aggttaggtttagtcgacagcatttggtgagaattgtttattttgattgctaaatgaacaattgtgttgtttatcaacaatgctgcagctaaaattgact |
509 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513877 |
aggttaggtttagtcgacagcatttggtgagaattgtttaatttgattgccaaatgaacaattgtgttgtttatcaacaatgctgcagctaaaattgact |
43513976 |
T |
 |
| Q |
510 |
gttggtttgatg |
521 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43513977 |
gttggtttgatg |
43513988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University