View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11603_high_23 (Length: 298)
Name: NF11603_high_23
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11603_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 3880942 - 3881221
Alignment:
| Q |
1 |
gataacagcacccgtagcacctagagaatgtgtcccggtaggttatcataaattttaaaagaagaaccctgattttcttttttggaacggtgaaaaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3880942 |
gataacagcacccgtagcacctagagaatgtgtcccagtaggttatcataaattttaaaagaagaaccctgattttcttttttggaacggtgaaaaattg |
3881041 |
T |
 |
| Q |
101 |
atcttttcagcgcaaactaatttcatgatgatacagataatggaccaaactgttagagctggagaacctcaacacaagcaggatcagcaaatgcagatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881042 |
atcttttcagcgcaaactaatttcatgatgatacagataatggaccaaactgttagagctggagaacctcaacacaagcaggatcagcaaatgcagatgc |
3881141 |
T |
 |
| Q |
201 |
agtcccaaaatctcgatgtattgtattcaacttttttaaatttcaaatcactgcactttacatttttggctacagaaagc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881142 |
agtcccaaaatctcgatgtattgtattcaacttttttaaatttcaaatcactgcactttacatttttggctacagaaagc |
3881221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 106 - 279
Target Start/End: Original strand, 3880700 - 3880873
Alignment:
| Q |
106 |
ttcagcgcaaactaatttcatgatgatacagataatggaccaaactgttagagctggagaacctcaacacaagcaggatcagcaaatgcagatgcagtcc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3880700 |
ttcagcgcaaactaatttcatgatgatacagctggtggaccaaactgttggagctggagaacctcaatgcaagcaggatcagcaaatgcagatgcagtcc |
3880799 |
T |
 |
| Q |
206 |
caaaatctcgatgtattgtattcaacttttttaaatttcaaatcactgcactttacatttttggctacagaaag |
279 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||| |||||||| ||||||||| || ||||| ||||||| |
|
|
| T |
3880800 |
caaaatctctatgtatggtattcaactttttaaaattccaaatcaccgcactttaccttgttggcatcagaaag |
3880873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 106 - 279
Target Start/End: Original strand, 3881661 - 3881834
Alignment:
| Q |
106 |
ttcagcgcaaactaatttcatgatgatacagataatggaccaaactgttagagctggagaacctcaacacaagcaggatcagcaaatgcagatgcagtcc |
205 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| | |||||| ||||||| |
|
|
| T |
3881661 |
ttcagcgcaaactaatttcatgatggtacagatgatggaccaaactgttagagctggagaacctcaattcaagcaggatcagccattgcagacgcagtcc |
3881760 |
T |
 |
| Q |
206 |
caaaatctcgatgtattgtattcaacttttttaaatttcaaatcactgcactttacatttttggctacagaaag |
279 |
Q |
| |
|
||||||||||| |||| |||||||| ||||| ||||| ||| |||||||||||||| || ||||| |||||||| |
|
|
| T |
3881761 |
caaaatctcgacgtatggtattcaagtttttaaaattccaattcactgcactttaccttattggcaacagaaag |
3881834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 9 - 60
Target Start/End: Original strand, 3881301 - 3881352
Alignment:
| Q |
9 |
cacccgtagcacctagagaatgtgtcccggtaggttatcataaattttaaaa |
60 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881301 |
cacccgtagtacctggagaatgtgtcccggtaggttatcataaattttaaaa |
3881352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 3881906 - 3881945
Alignment:
| Q |
5 |
acagcacccgtagcacctagagaatgtgtcccggtaggtt |
44 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3881906 |
acagcacccgtagcatctagagaatgtgtcccggtaggtt |
3881945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 30342176 - 30342215
Alignment:
| Q |
5 |
acagcacccgtagcacctagagaatgtgtcccggtaggtt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30342176 |
acagcacccgtagcacctagagaatgtgtcctggtaggtt |
30342215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 18987587 - 18987550
Alignment:
| Q |
7 |
agcacccgtagcacctagagaatgtgtcccggtaggtt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18987587 |
agcacccgtagcacctagagaatgtgtcctggtaggtt |
18987550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 44
Target Start/End: Original strand, 23917936 - 23917973
Alignment:
| Q |
7 |
agcacccgtagcacctagagaatgtgtcccggtaggtt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23917936 |
agcacccgtagcacctagagaatgtgtcctggtaggtt |
23917973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University