View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11603_high_24 (Length: 276)

Name: NF11603_high_24
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11603_high_24
NF11603_high_24
[»] chr5 (1 HSPs)
chr5 (9-261)||(2945789-2946041)


Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 261
Target Start/End: Original strand, 2945789 - 2946041
Alignment:
9 agcataggcataaaaaacatgtggataatttgcaaaatattgatgataaccatcctgcacatcacaaacacagaaaggaacaggacccttctacaggact 108  Q
    ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2945789 agcatagacatagaaaacatgtggataatttgcaaaatattgatgataaccatcctgcacatcacaaacacagaaaggaacaggacccttctacaggact 2945888  T
109 gatcaaagatctgaggcatgataagataaggcatgcaaattatggaaaacacaaacaagttttggtatatgatcctggggctgagtagagaaagttccaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2945889 gatcaaagatctgaggcatgataagataaggcatgcaaattatggaaaacacaaacaagttttggtatatgatcctggggctgagtagagaaagttccaa 2945988  T
209 ttcaatgcagttagttatctcttagaaagtacaatgttttagattaactttgt 261  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2945989 ttcaatgcagttagttatctcttagaaagtacaatgttttagattaactttgt 2946041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University