View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11603_high_24 (Length: 276)
Name: NF11603_high_24
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11603_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 261
Target Start/End: Original strand, 2945789 - 2946041
Alignment:
| Q |
9 |
agcataggcataaaaaacatgtggataatttgcaaaatattgatgataaccatcctgcacatcacaaacacagaaaggaacaggacccttctacaggact |
108 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2945789 |
agcatagacatagaaaacatgtggataatttgcaaaatattgatgataaccatcctgcacatcacaaacacagaaaggaacaggacccttctacaggact |
2945888 |
T |
 |
| Q |
109 |
gatcaaagatctgaggcatgataagataaggcatgcaaattatggaaaacacaaacaagttttggtatatgatcctggggctgagtagagaaagttccaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2945889 |
gatcaaagatctgaggcatgataagataaggcatgcaaattatggaaaacacaaacaagttttggtatatgatcctggggctgagtagagaaagttccaa |
2945988 |
T |
 |
| Q |
209 |
ttcaatgcagttagttatctcttagaaagtacaatgttttagattaactttgt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2945989 |
ttcaatgcagttagttatctcttagaaagtacaatgttttagattaactttgt |
2946041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University